executable matlab version of the single-cell debarcoder tool Search Results


95
MathWorks Inc matlab single cell debarcoder
Matlab Single Cell Debarcoder, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/matlab single cell debarcoder/product/MathWorks Inc
Average 95 stars, based on 1 article reviews
matlab single cell debarcoder - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

90
Synthego Inc cd9 multi-guide rna probe2: cuugguuuucagcuuguugu
Cd9 Multi Guide Rna Probe2: Cuugguuuucagcuuguugu, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cd9 multi-guide rna probe2: cuugguuuucagcuuguugu/product/Synthego Inc
Average 90 stars, based on 1 article reviews
cd9 multi-guide rna probe2: cuugguuuucagcuuguugu - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad software 8.0.2
Graphpad Software 8.0.2, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad software 8.0.2/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad software 8.0.2 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
TechLab Inc tetanus toxin c-terminal fragment
Tetanus Toxin C Terminal Fragment, supplied by TechLab Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tetanus toxin c-terminal fragment/product/TechLab Inc
Average 90 stars, based on 1 article reviews
tetanus toxin c-terminal fragment - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

96
MathWorks Inc cell matlab debarcoding tool 111 manual gating
Cell Matlab Debarcoding Tool 111 Manual Gating, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cell matlab debarcoding tool 111 manual gating/product/MathWorks Inc
Average 96 stars, based on 1 article reviews
cell matlab debarcoding tool 111 manual gating - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

Image Search Results