95
|
MathWorks Inc
matlab single cell debarcoder Matlab Single Cell Debarcoder, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab single cell debarcoder/product/MathWorks Inc Average 95 stars, based on 1 article reviews
matlab single cell debarcoder - by Bioz Stars,
2026-05
95/100 stars
|
Buy from Supplier |
90
|
Synthego Inc
cd9 multi-guide rna probe2: cuugguuuucagcuuguugu Cd9 Multi Guide Rna Probe2: Cuugguuuucagcuuguugu, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cd9 multi-guide rna probe2: cuugguuuucagcuuguugu/product/Synthego Inc Average 90 stars, based on 1 article reviews
cd9 multi-guide rna probe2: cuugguuuucagcuuguugu - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
graphpad software 8.0.2 Graphpad Software 8.0.2, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/graphpad software 8.0.2/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
graphpad software 8.0.2 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
TechLab Inc
tetanus toxin c-terminal fragment Tetanus Toxin C Terminal Fragment, supplied by TechLab Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tetanus toxin c-terminal fragment/product/TechLab Inc Average 90 stars, based on 1 article reviews
tetanus toxin c-terminal fragment - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
96
|
MathWorks Inc
cell matlab debarcoding tool 111 manual gating Cell Matlab Debarcoding Tool 111 Manual Gating, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cell matlab debarcoding tool 111 manual gating/product/MathWorks Inc Average 96 stars, based on 1 article reviews
cell matlab debarcoding tool 111 manual gating - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |